SesameFG: Sesame Functional Genomics Database

 

 

Polymorphism SSR markers could be widely used in the QTL mapping, genetic diversity analysis and evolution study of sesame. Two hundred and thirty eight polymorphism SSR markers have been developed from more than 2000 SSR markers. They are listed in the table below.

SSR ID Located scaffold Located LG Repeat type Foward primer seq Reverse primer seq Tm (℃) Product size (bp)
ZMM23 scaffold00067 5 (AG)9 CTGAAGTTCAAGCTCCTGCC CCTGACTCCAACACCAACCT 55 249
ZMM29 scaffold00067 5 (TAAA)4 TTTTATGGTGTTGTGGGCTG CAACTTCTGCAACCCATTGA 55 250
ZMM38 scaffold00071 12 (TG)7 AGCTATGCCCTCTACCATAGG CCATTTTGAGGACAATGCAA 55 243
ZMM39 scaffold00071 12 (AT)6 TTTCCATAAGGGGGTATTTGC GGGATCGATGGTCTAAAAATTC 55 245
ZMM45 scaffold00071 12 (TA)14 TGGAATGGTCAAATGGGTTT CTGCCTCATCGTTACACCCT 55 179
ZMM67 scaffold00074 12 (TA)12 ACATGTGCTAACGTGGACGA TAGAAAAACGCAAGCAACCC 55 203
ZMM70 scaffold00074 12 (TA)15 AGATGCATTCCCTGGACATT TTTGGTATGCAAGGATGCAA 55 269
ZMM93 scaffold00079 4 (AT)11 TCGAGCTGAAGATCGACAAG TTGCTTTTTGGTTGTTGTGG 55 279
ZMM95 scaffold00079 4 (CT)21 GGACTCATTCAGTGGACCGT TTCTTCCCACCTTCAACACA 55 199
ZMM98 scaffold00079 4 (AT)11 TTGCAAAATTTCAAAGAACGTA TCAAACGAAAGGAGCGAGTT 55 274
ZMM126 scaffold00083 7 (AT)8 ATATGGCGGTGTCCTAACCA CATGCAGAAATAACATGCCA 55 106
ZMM128 scaffold00083 7 (AC)16 TCCCATCATTCAATTGGACA GCATGCAAAGACGTGACAAC 55 107
ZMM162 scaffold00086 4 (TA)10 TCCTCCATCATGCACTTGAA TTTCATCCGTTCTCGTCTCC 55 191
ZMM187 scaffold00093 14 (AT)11 CAACGTAAATTTTGTATTTTACCAAT CAAACGACCCCATACTCTTTG 55 272
ZMM193 scaffold00093 14 (AG)12 TATTAAGGGAGAAGGGGCGT ATTCCCAAGTCCAAAAAGGG 55 255
ZMM205 scaffold00094 15 (AT)15 TTTTTGGGAAGAAATTGCATAAA CCCTTTGGGATGGCTACATA 55 263
ZMM219 scaffold00096 7 (AT)12 ATGAAACCTAACCAGGGGGA GAGCTGTAGGTGGTTCAGGC 55 151
ZMM220 scaffold00096 7 (AG)9 CGTTTACACCCCCTTCAAAA CCTCTCATTTTAACATTTTTCGTG 55 274
ZMM227 scaffold00096 7 (TC)21 GACCCACATCGAATGTGAAA TGAACTCTTCAACTATACAATGGGA 55 278
ZMM256 scaffold00099 11 (AT)8 GACCAACTCCACATACACTTGC AAACACCCACCACCCTATCA 55 273
ZMM268 scaffold00100 13 (TA)6 AGGCATTAGCACAGTCAGCA ATGAGACGAGCATCCAGACA 55 251
ZMM287 scaffold00102 15 (TC)20 CACCACCACTAAGACAGCGA TGTGCAGATCATGATAGGGG 55 273
ZMM289 scaffold00103 13 (AT)11 CACCGCACCGTATAACTTCC CGTGAATTAAACATTAGTATCCCACA 55 264
ZMM294 scaffold00103 13 (TCA)5 GGCCAACCCTTTTCAGATTT GGGCTTCACAACACAAGACA 55 205
ZMM307 scaffold00104 13 (CT)13 TATGTCGGCCGTCGTATCTT ACATTCTTCCCTAGCTCGCA 55 243
ZMM312 scaffold00105 5 (ATA)5 GGGACGTGATGGATATTTTGA TACCTCCGCCGCTAGCTACT 55 208
ZMM313 scaffold00105 5 (ATT)8 CGAAGAATCAAACACAAACCA CTTGGGCTGTTCTGTTGGAG 55 279
ZMM314 scaffold00105 5 (AT)9 GGCACCAAGTTTTGATGGTT TTTTGAGATGGTTGAATGGG 55 278
ZMM318 scaffold00105 5 (AT)12 ATGATGATGGGGCGAGATTA CCCACCTACACACACATTGC 55 215
ZMM332 scaffold00107 16 (TA)15 TGATCCCTTCAAATTGGCTC GAAGGCCAATTCAAATCCAA 55 257
ZMM334 scaffold00107 16 (AT)14 AATTGGACTCCGGCTAGGAT CGCCCTCATCCTTACAATCT 55 204
ZMM348 scaffold00109 NA (AT)9 TGTAATGTATCTTTCAAGGGCAAA CGTAAAAATCTCGACCGCAT 55 265
ZMM361 scaffold00110 NA (AAT)4 GGGCCTATCCCAAGTATTGA GCTTGCGTCCCAAAAATAAA 55 278
ZMM365 scaffold00111 11 (TA)13 TAAGGAGGCCACTTGCTCAT AGTGTTGGGTGAGGGAAAAA 55 259
ZMM382 scaffold00112 (AT)6 TCTTATCCCAACATTCGCAA TGTCAAGTTGTTTGCAGTTGG 55 133
ZMM391 scaffold00113 3 (TAT)8 TGGGTTTTGATTTTGACTTTTTG CAATGTAAGATGATAGCTAAATCAATG 55 273
ZMM398 scaffold00114 4 (AT)10 TGGTTGTTTGATGATTTTCGAC TCCCACCAAAACCAGGTAAA 55 274
ZMM404 scaffold00115 6 (TC)25 TATGAACCCAACTTGCACCA CATTTTGTCTCCTTTCTTTTTAAGG 55 207
ZMM417 scaffold00116 1 (AT)12 GAAAACAGGCACTACCTTCCA AGTCGGACCAAGTTTGGCTA 55 275
ZMM425 scaffold00117 14 (AT)15 CAAGTCGCCATCACACTCAT TCGAGTTGGAATGCAACAAA 55 241
ZMM426 scaffold00117 14 (AT)16 CATCAATCACATGGCACGAT ATGCGAAATCTTTGCAGCTT 55 268
ZMM442 scaffold00119 NA (CA)8 GCATCATCTTGACGCTTTGT TTGGTTTCTTCGTTTGACCC 55 201
ZMM445 scaffold00119 NA (TA)9 GGCGAAAAGAGAAAATGCAA GGACATAATGGGTATTTTGAGAAA 55 241
ZMM452 scaffold00120 NA (AT)11 CCTAGAGTGGATGGCATGTG TTCTGCAGCATCCTCTAACTG 55 247
ZMM455 scaffold00120 NA (TA)12 AGCCAGCTGGAATGCACTTA GCATTTTAGGAGTCGTGGGT 55 150
ZMM456 scaffold00120 NA (AT)11 TTGCAAAATTTCAAAGAACGTA TCAAACGAAAAGGAGCGAGT 55 278
ZMM459 scaffold00121 NA (TA)12 TGTCCGAGTGAGGTATGCAA TTAACTAAGGAGTTTACAGGGAAAAA 55 194
ZMM479 scaffold00124 NA (TA)9 TGGAGTAGCGAGCATAGAGGA GGCGATAATACAACCACCAAA 55 280
ZMM515 scaffold00128 NA (TA)14 TGGCTTCATTTTGGATGGTT GAGGAGTGACCTATTTGTTAGACGA 55 157
ZMM518 scaffold00128 NA (CA)11 TGGGTTTATTTCAATGCCAA CGCCAAATTCATCTTGGACT 55 258
ZMM525 scaffold00129 10 (ATTA)3 CCATGCATGTAATTAGAGCAAAC CGCATAAACAATGGTGGCTA 55 245
ZMM526 scaffold00129 10 (AT)10 CTCGATTCTGGACGGATGAT AGCGGGTGTTTGATTTGAAG 55 226
ZMM533 scaffold00129 10 (TA)6 TCGACGCTATTCTTTCACAAG AAAAGGGGTTGAGTGTCGAA 55 232
ZMM545 scaffold00131 4 (TA)11 AGAGCAAATGTTTTGACCGT CAATGTTCATGTCAATGACGAA 55 249
ZMM570 scaffold00133 4 (CT)11 CCTTCAAGCTTGCACCATTT GCAAACCTATGCATCTCCCT 55 219
ZMM582 scaffold00134 2 (TAT)5 GGCACGAACACCTAACTGGT AAAGAGCCTTTTGTAATTCACCC 55 122
ZMM583 scaffold00135 7 (TATT)3 TTGCTTGTTGTAAATAAATTGCC TCGTTATTTGTGAAAGTTTTCTTTTC 55 112
ZMM585 scaffold00135 7 (AT)6 TTTTCAGCTTATTTTCACCAATAAA TCAAGTAATCTTCAACTACTACCAACA 55 229
ZMM587 scaffold00135 7 (AT)16 AGATTGCCTGAGAAGCCATT AATCAATCGCCGTACCTGTC 55 221
ZMM590 scaffold00135 7 (AG)15 GGAACACATTGATGCCCTCT CCACTTGCTCACTCACTCCA 55 276
ZMM598 scaffold00136 10 (AT)13 TACTGGAACTTGGTACGCCC GCATAACCAAACATCTATGTGGC 55 252
ZMM601 scaffold00136 10 (TC)9 GGGGTGGAGTGTAATTATCCG GTCATGCTCCAAAAATGGCT 55 269
ZMM602 scaffold00136 10 (AT)12 CTTGTTGTGGTCTTGGACCC GGACAGCAAGAGCATGATGA 55 270
ZMM604 scaffold00137 3 (TA)10 CTGTGTGGTCATTCAGTGGG AACATCCCTCATATTTGTTTGACA 55 240
ZMM609 scaffold00137 3 (TAT)4 CAAAAGATCATGGGTTTGGG ATGTCGCGCAATCAATAGGT 55 193
ZMM619 scaffold00138 13 (AT)13 AACCATTGAGAAAGGGACGA TTATACGGAGGAGTGACGGC 55 204
ZMM627 scaffold00140 4 (TA)13 GCACTCCACTTTGGGTAAGC TACCAAGGATCGGCCTTATG 55 246
ZMM628 scaffold00140 4 (AT)10 GACGCACTGAATCAAATCAAA GAGGAGAGGTGCCATGACTT 55 238
ZMM630 scaffold00140 4 (AAAAG)5 CGAAGGGTGTGTATGTGGTG GGAAGGACGTAATTGGTATTTTG 55 278
ZMM637 scaffold00141 NA (AT)14 ACGCGAAGGCTCAAGTAGAA TCGGAATTTTGGATTTGGTC 55 247
ZMM661 scaffold00143 NA (CAAA)3 GTTGTCTGCTGTTTCGAACG TCATCCATACATCCAATGTACAAA 55 216
ZMM689 scaffold00147 11 (AT)9 CGCTTGAATTAATTGCATCTACC CCAAGTGAACATAGAAATCTGCC 55 226
ZMM701 scaffold00148 NA (AT)11 TCGAACAAGCACAGGAATTG GGGCGTAAATGGTATTTTGAGA 55 277
ZMM708 scaffold00149 8 (AT)14 GCACCCTTAACTTGGCATTC TTGATGCAGTTATGTGCTCACT 55 149
ZMM715 scaffold00150 16 (AT)12 CCCCTCTCAAATAAGCCCTC AGGAAGGAGGGTGTCCCTAA 55 196
ZMM718 scaffold00150 16 (TA)9 GAAATCGAAGCATTTTGGGA TGAATCCAAGTTCACGATCAA 55 133
ZMM732 scaffold00151 4 (CAT)8 TGCCAAAAACACAAGAATGA TGCATGCTCTCGTACGTGTT 55 258
ZMM734 scaffold00151 4 (AG)9 CCAGACCCAAACCCAATAGA TGCATTTAAGGCTGTGCAAC 55 264
ZMM735 scaffold00151 4 (TG)9 AATTTATCCGCCTGCACAAC CGACATTGCATAGATGAGCG 55 154
ZMM746 scaffold00152 7 (TA)9 TGAAAAGTGCCATGTCAGTCA GGGCTACCGATTGGATTTCT 55 239
ZMM750 scaffold00154 6 (TC)21 TTCCTCAAGATTAGCTGCGG CCGAGCACCTTAAACCAAAC 55 268
ZMM760 scaffold00155 NA (TA)10 ATTCTTGAACTGGGTCGGGT GGGAAAAACAATTGTGTATATTTGC 55 206
ZMM788 scaffold00158 4 (AT)8 TCTTCCGATTAATATTTTCGTGC TCATGTATTGATTGAATCGACG 55 210
ZMM799 scaffold00160 10 (TA)6 TGTCCTGGAACACTAAGGGC CCAGTTCCACTGTCCCTCAT 55 232
ZMM801 scaffold00160 10 (AAG)5 ACTGATTTTGTAGCAGGGCG TGTCTCCCAATTATCACGCA 55 267
ZMM805 scaffold00160 10 (TA)18 TCAGTACCTTAAATCAAGCCGA GTGGGCGCAGTTAGCTGTA 55 249
ZMM806 scaffold00160 10 (AT)13 TATTGGGTATCGTCACGGGT TTCTAAGGGATTTGGTTAGCCT 55 218
ZMM822 scaffold00162 7 (AG)7 TTTAGGAAGGATGTGATGGG GGTGTGTGTTGTGTGCTGTG 55 262
ZMM826 scaffold00162 7 (TA)7 CCATTTTTCTTCCAAAGGGA TCTTATCCCAACATTTGCAATTTA 55 259
ZMM853 scaffold00165 NA (GT)11 ATGATGGTGATGCTGATGGA TGAAATCTGTGGGAGAAGCC 55 253
ZMM854 scaffold00165 NA (ATG)4 CCCCTGACCTTTCAGTTACG ATCCTATGCACCACACAGCA 55 199
ZMM855 scaffold00165 NA (TA)7 ATTTCCAGCCAAATTGACCA TTGATGCCAACATTATCGGA 55 244
ZMM856 scaffold00165 NA (TA)14 CGACCAATGATATTTTTGCTTGT TGGAAATGTTGGGAATGTGA 55 208
ZMM898 scaffold00170 3 (CTCCGC)4 TGCTCGATCCAATATCACCA TCTCACCTCTTCTCCCTCTCC 55 225
ZMM901 scaffold00170 3 (CTG)5 ACTGGGCAATGGTTTTCTTG GGGATGAAATGAGGACAGGA 55 204
ZMM913 scaffold00171 12 (TA)13 CTCATGTGGAACGAGGCATA ATGGCCACCACCTAACATTC 55 227
ZMM948 scaffold00176 14 (TA)13 TCCAAATACGCAACGAACAA TTCATCCATCCATCCAAAGA 55 279
ZMM987 scaffold00180 1 (AT)15 CTTTGATTGGGCCACCCTA TGTTTGTTCTTCTTCCCCCA 55 280
ZMM990 scaffold00180 1 (TC)6 AGATCGTAACTCCGGACCCT TTTGGAGGAGGAAATGTTGC 55 259
ZMM993 scaffold00181 7 (AT)7 TCAGTCAAGTCAGGCCAGTG ACGGGCATAATCAACCCATA 55 176
ZMM995 scaffold00181 7 (AAT)5 TTTAGAAAGGGCGTAATGGG AATTGTTTGTGTGCGCATGT 55 237
ZMM997 scaffold00181 7 (AAT)6 GCCCAATTAACCCATGTTGT CAAGAGAGAGAAAGTGATGGGTTT 55 279
ZMM1002 scaffold00023 10 (TA)7 CGCTTTTTAGCCGTTGAGAC TGCCGATCCTTCTCCTTCTA 55 161
ZMM1004 scaffold00023 10 (AT)11 GAGACACCCAACGATTTTGC TCCCTTCGAAATGGTATCTCC 55 251
ZMM1006 scaffold00023 10 (AT)14 CGGCCGAGAGAGTGAGACTA CGTAATTGAGCGCATTGAAA 55 265
ZMM1007 scaffold00023 10 (AT)15 TTCACAAGGGGGTAATTTGC TCTGGCATTGCAAACACCTA 55 162
ZMM1011 scaffold00025 2 (AT)13 CCTTGCCAATGAAACTTTCTC AATCATTTCCAGTGGGGACA 55 229
ZMM1018 scaffold00025 2 (AT)10 TGCAAATGTTTGGATAGCACA TGAGAATCGGCCAATTAAGAA 55 280
ZMM1020 scaffold00025 2 (AT)11 CTGCCATTGCATCATCAACT GGCGAGGTAGGCACAGATTA 55 253
ZMM1021 scaffold00025 2 (TA)13 CGCACTGGAGTGAGAGAGTG CATCATCTCGAACGCTTGAA 55 234
ZMM1022 scaffold00026 16 (AT)7 TTTGCCTCTTAACATTTTCCA TTGGGTCTGTCTCCTCGTTC 55 269
ZMM1023 scaffold00026 16 (TA)7 TTGGAGCCAGGAAGATTTTG ATGGCCCAGGTTAGTGTCTG 55 260
ZMM1028 scaffold00026 16 (GA)12 GCTGATGAAATCTCGACCGT GTTGCTTGCATTTTTCCCTC 55 223
ZMM1029 scaffold00026 16 (AT)6 TATCACGCGACCGAAATACA ATCGGGGGTTGTGTTAGTCA 55 244
ZMM1033 scaffold00030 3 (AT)14 CGTAGTGGTTCCCCTCACAT ATGCTTTCCCCCAAATAACC 55 179
ZMM1035 scaffold00030 3 (TTA)5 AATTGTCCTTCTCGGTGGTG CTGCATCAGGATCTCCGAA 55 270
ZMM1042 scaffold00033 9 (TA)12 AAGGGTGGGAGGAGAGAGAA AACGGTTTGGACAAAGATCG 55 235
ZMM1043 scaffold00033 9 (AT)10 CCCGAAAATAGGATTTCTAACCA TTTTGGACTGCTATTGAGGGA 55 184
ZMM1045 scaffold00033 9 (AT)12 CAGCATTAGCGTCTCGACAA TTTTTCATCCACCTAGTCCGA 55 251
ZMM1047 scaffold00033 9 (AT)11 GCGTTGTAATAACAGGGCGA TGATTGGTTTGATTCGGTCA 55 232
ZMM1049 scaffold00034 8 (AT)9 GTGCATGGATGGAATGACAA TGCACCTCACAAAACCAACT 55 252
ZMM1050 scaffold00034 8 (AT)12 TTAAGGTGGCTGATTTTGGG GAATAGTCCGGCAATGCTAAA 55 234
ZMM1053 scaffold00034 8 (AT)11 AAGCAATGCTGCTGCTACAA CCCCTACCCCAAACCTAAAC 55 207
ZMM1064 scaffold00039 2 (GA)12 TGGCACCATGATAGGACAAA AAACTTGATCACCCACAAAACA 55 247
ZMM1065 scaffold00039 2 (TC)8 TCTACATTTACACGTGCCGC AAAATGGCACAGTCTTCGCT 55 278
ZMM1081 scaffold00047 7 (AT)14 TGTCCGTGTTTCAGCTTTTCT CAAATTGCGGGCTCATCTAT 55 265
ZMM1082 scaffold00047 7 (GTT)5 AAGGAAGCGAAGAGAATGGG GCGTGGTTTCTTGAACGATAA 55 278
ZMM1086 scaffold00047 7 (TA)13 TGATTTTATTGTGGGCTTTCC CTTGCATGCAGACACGATG 55 277
ZMM1088 scaffold00057 NA (GT)6 CGGATTAAATTGGAGTTCGC GTACCTCTGTTTCCTCCGCA 55 268
ZMM1094 scaffold00057 NA (AT)7 TGCTGCAAGATTACAAGCAAA TAGCTGCCAGCAATTCATAA 55 148
ZMM1109 scaffold00062 4 (TA)18 TCACTGAAGGCGAAAAGAAAA AAATCAGAAAGGACGTAATGGG 55 280
ZMM1119 scaffold00062 4 (TCT)5 GGCAAAGTCGTTCCAAAAAT AACTTACCTGGTGGTGGCTG 55 258
ZMM1121 scaffold00064 9 (TA)11 TTCAAACTTCATGGGAGGAGA GATTGGGCTGAGTCCAGAAA 55 208
ZMM1123 scaffold00064 9 (AG)12 AACCTCACCGCATTCAACAT TATCGCTCACACTGTTCGGA 55 153
ZMM1124 scaffold00064 9 (AAT)6 AACTTGAACAGGATAAATTGGAGC TGCTGGTGTAATTGTGTCTGTG 55 276
ZMM1128 scaffold00064 9 (AT)18 GATGTCATCAATTTGTTGTTTAAGA TGCTTGTGGCTAGAAAACTTAGAA 55 265
ZMM1131 scaffold00066 15 (TA)11 TTATGGGGAGAACTAGGGGC TGGGGTTTCCATTATTGCTC 55 181
ZMM1133 scaffold00066 15 (TG)7 GCAAGCATGAATTAAAGTGTTCC ATGTTGATCCACACGGGC 55 229
ZMM1135 scaffold00066 15 (CT)17 GAGAGAGATTTTGAGGCGGA TGTTGATGGTGTCTGGTATTTGA 55 273
ZMM1144 scaffold00067 5 (TA)13 AGTTATTTTAAAGGGTCTTCTCGTT AAGAGTCTGCCCATGACACC 55 160
ZMM1151 scaffold00067 5 (TA)14 CACGTAATTCATCGTGATCCA AGAAGTTTGAGTTTGGCGGA 55 253
ZMM1155 scaffold00067 5 (AT)12 TGTCCACATCAAATGTCCCT TGTGGAACTCGAATTTGTGAA 55 213
ZMM1161 scaffold00069 2 (AT)14 GCAGAAATAGAACTTGGAGGGA TCTGCTAGAACATCGAAACTCAA 55 189
ZMM1163 scaffold00069 2 (AT)8 AATTACAAGGCGGGTAGCCT CAACTTCTTCATGTTCGTCCTT 55 261
ZMM1166 scaffold00069 2 (TA)18 ATCCCCTGAGGAGTGTCGAT GCACAAACATCCCTGACCTT 55 151
ZMM1168 scaffold00069 2 (AG)13 GCACCACAATTGTCGAAGG TTCATCTCACAAGTTCCACCA 55 277
ZMM1174 scaffold00074 12 (AT)12 AAAGCACGAATTGATGCCC GCAATTAATCGTTTAGTTCCATATT 55 278
ZMM1182 scaffold00074 12 (AT)11 GCTTCCAAGGATACACCCAA TGACTCTGCCTGTCCTACCA 55 197
ZMM1187 scaffold00075 8 (AG)11 CGAATCCTGTTCTCCCAAAC AAACCAAACATGGGGAGTTG 55 187
ZMM1188 scaffold00075 8 (AT)11 TTATGGTTTGAACTGCCACAA ACGACGACGACGACAATCTA 55 242
ZMM1189 scaffold00075 8 (GT)8 TATCCAGGGGAAAACCAGAA TTGGATTTTCCTTCTCACGC 55 212
ZMM1190 scaffold00075 8 (AT)13 GAGCCAAATCTTAAGGGTTTCA TTGTGAGGATCGGAAAGACC 55 207
ZMM1194 scaffold00075 8 (AT)10 TTCCAATTCTACAAGCGCAG CCGATCAAAACTAGTATGGCAA 55 274
ZMM1197 scaffold00075 8 (AT)13 CGTATGACGTTAACTTCGCAGA AAAAAGGAGGTGGCGATTAGA 55 187
ZMM1201 scaffold00076 9 (AT)15 TTTTCTCCTATTGCGCTCGT GGACCCCAACAACAGCTAAA 55 264
ZMM1203 scaffold00076 9 (TA)9 TTAGGGCCTAGGGTACGGAT TGCATCACTTTGTGGAGTGG 55 256
ZMM1206 scaffold00076 9 (AC)6 CACCACCCCATTGGACTAAC GAGAAGGGGATTTTGCTGTG 55 229
ZMM1208 scaffold00076 9 (AT)11 TTGTGCATTTTGAAGGATCG GGCATTGGCAAACTTTGATT 55 184
ZMM1209 scaffold00076 9 (AT)10 ACTTGTGGAAATGGTCGGAG GCGTGGATTAGGTGGTGACT 55 266
ZMM1211 scaffold00077 13 (AT)11 CCATACTGCTGCTGTTGCTG TCCATCAAGAGTTTCTCGGG 55 271
ZMM1217 scaffold00077 13 (AT)11 GTGGCGGAGTACAGTTTGGT TCATTTTCAATGTCACAGGAGG 55 214
ZMM1219 scaffold00077 13 (AT)13 TTACACGATCAACATAAATTCAAGA TCCATAAGAATTTTTCGCCTTT 55 263
ZMM1231 scaffold00080 7 (TC)17 GTAACCCTATTCCCCCGTGT GCCAGAAAACAATCAAGGGA 55 195
ZMM1234 scaffold00080 7 (AT)16 TCAAACAAAAGTGACAGCCAA CATGCATGAGTCGTAACCAGA 55 255
ZMM1235 scaffold00080 7 (AT)9 TGTGTAGTCCCTAGACGGTGAA TTTATGGTGAACTGACCAAAATGT 55 228
ZMM1240 scaffold00082 4 (AT)9 GGACGCATACACAACCACAT TTTCGATAACCGAGGAATGG 55 280
ZMM1242 scaffold00082 4 (AT)13 CCTCCCTAGATTTTCGATTGC GGCACATGTTCACAAATCCA 55 280
ZMM1243 scaffold00082 4 (AT)12 GGAAATCAGGTCCCTGTCAA TTCCCTTTCCGATGTACCAA 55 233
ZMM1244 scaffold00082 4 (AT)10 TTTACGCCAGCACGTACATA GGGTTGAGGTGAAGTAGCCA 55 245
ZMM1247 scaffold00082 4 (TA)17 GCTCCCAAGCTGCATATGAT GTTTGCTAGGCACCAGAAGC 55 216
ZMM1252 scaffold00083 7 (AT)13 AATTTTATGGAGGCCCAAGG AACTCCCCCATCCTTACAGC 55 151
ZMM1258 scaffold00083 7 (AT)12 TTTTAAACCTTTTGTTGCATGTG TGGGATCATTGTTGCTTCCT 55 280
ZMM1259 scaffold00083 7 (AT)13 TGACAAGTTGCGTGGTTGAT GGCCATCTTTTGTGCAAGTT 55 280
ZMM1266 scaffold00085 6 (TA)15 TTTCACATCCGTTGGATCTT GCTGAGCTTTTGCTCCATTT 55 271
ZMM1268 scaffold00085 6 (AT)15 TGTGGTTTCAAATAAAAAGTTGGA TCGATTGTTTGGAGGATTTTG 55 198
ZMM1270 scaffold00086 4 (AT)14 TCGAATTTTCGTTGATATTGGA ACACCGTCCTGAAACTACGG 55 247
ZMM1288 scaffold00091 9 (GT)9 AAGGGCCCTATCTAGTGGGA GAAAAAGGGGATGAGGTGGT 55 155
ZMM1291 scaffold00091 9 (AG)21 TTCCAGCCTTAACGCGTAGT GATATCATCACCTGGCAGCA 55 251
ZMM1295 scaffold00091 9 (CT)12 AGGGCTCCCAACTTGAGATT TTGGTTGGTGTGATTGCATTA 55 230
ZMM1299 scaffold00091 9 (AT)13 TGGAGGGATAATTGTTAGGCA CATGGGGTTTAGTGTGGCTT 55 243
ZMM1303 scaffold00093 14 (AT)11 TCCCAATCAGTTAGGTCGAG TTAAGCTTAGGGGTCGGGTT 55 182
ZMM1305 scaffold00093 14 (AG)11 CGCCGCCTATATATGCAAGA CCCTGTTTGTTGGAAGCATT 55 234
ZMM1306 scaffold00093 14 (AT)10 AGGGCAATTGAGCAATGTCT CATGCCATTGTAGCAAGCTG 55 249
ZMM1307 scaffold00093 14 (AT)12 AAAAGCAGGGGACAATTCAT CAAAACTCGAGAAAGGTGGC 55 280
ZMM1308 scaffold00093 14 (AT)11 TTTCGTTAGGGTTTGAACAAAAA CACTCTTCCGTAAGGATTTGAA 55 278
ZMM1337 scaffold00099 11 (AT)10 TGTTGGTACTCAATCCGTTCA TCTGTCAGACCTTGCTCGATT 55 216
ZMM1342 scaffold00100 13 (CT)18 ATGAAAGTGGGTCGATCAGG TATGATTTTTGCAAGCCACG 55 269
ZMM1343 scaffold00100 13 (TTA)4 AATGTGAAGTTGCGGACACA CTAAAACGGATTGTGGGGTG 55 197
ZMM1344 scaffold00100 13 (AT)12 CCCAAAGAATTTCAAGTTCCC CGTGATGTCTAACACGATAAGGA 55 163
ZMM1350 scaffold00100 13 (TA)18 CCTTTTTGTGTTGTGCGAAA CGTCCTATGTGCGATTTTGA 55 229
ZMM1351 scaffold00100 13 (AT)13 ATCAAATATGATCGTTGTTGTCA GGTTCCTTCTTCATTTTTCCA 55 253
ZMM1352 scaffold00100 13 (TA)12 AGAAACAGTTTGGGTGACGG CCCGTGATCCCCTCCTTAT 55 269
ZMM1353 scaffold00100 13 (TA)16 GCCAAAACAAAGGATTCAAGA TGAGCTTTGTGTGACCATGA 55 169
ZMM1354 scaffold00101 7 (AT)11 AGTAATAGGGTCGGCGGATT AACGTCCGAGTACTTCCTGG 55 237
ZMM1357 scaffold00101 7 (ATA)7 TGGTCCGATTAACTCATGTTG CTGCAACCCAAACCTAGGAG 55 210
ZMM1362 scaffold00101 7 (AT)11 TCACCAACTTCTCATTCCAAAA GGGTTGTTTGCATTTGTTCC 55 250
ZMM1363 scaffold00102 15 (AT)15 CAATGGATAAGGAGGCGAAA ATCGGTCATTCCAATCCTCA 55 262
ZMM1367 scaffold00102 15 (AT)13 CATAAAACCAGCAGAGCAGC TAAACCTCGACCTGACGCTT 55 250
ZMM1368 scaffold00102 15 (AT)11 TCCATCGATGCTGGACTGTA CAAGTTAAATATATGCTGTACATGTGG 55 246
ZMM1370 scaffold00102 15 (TA)10 CATCAGTGCCTTTGTTGGTG TCCAATTTTGTTTCCATCCG 55 274
ZMM1383 scaffold00016 8 (TA)13 TCATTAACCCATCATTGCGA TGCTCACACATAACAGTTGGG 55 248
ZMM1393 scaffold00023 10 (AT)11 ACTTGCAATTTTAGTCCGGC CCAAACCAAAACGTACCCAC 55 260
ZMM1394 scaffold00023 10 (AT)11 GGACCAAAAGTTTGACACGG GGAGGTGAGAAGTCGCGTAG 55 260
ZMM1399 C00406 NA (AAT)5 TTGACTTGCCTCATGCATTT TGCAGTTCAATTGTCTGGGA 55 253
ZMM1402 scaffold00043 10 (CA)6 ATTATGCGCGTCAGTGTGTG CGCTATAATATTTGGGGGCA 55 229
ZMM1404 scaffold00043 10 (TA)9 GAAAACGAAATGGAGGTTTGA TTAACACAAAGAGCTGCTCAAC 55 257
ZMM1415 scaffold00065 1 (AT)11 TGTTGTTTGACCGTCTTCCA TCGGGCTAGAAACCAACAGT 55 267
ZMM1423 scaffold00078 5 (AATT)3 TTTAATAATTCATTTGATGGATGG ACTTCAAGTATGCGTTGGGC 55 276
ZMM1424 scaffold00078 5 (TA)6 CGTCCGAGGATGTGTGTTTA GCTCGTTATAATATTTGGGAGCA 55 273
ZMM1437 scaffold00087 5 (AT)14 CACGCTAACATTTATATCATTTGACC CCAGTTTGTGTACTCGATCCC 55 155
ZMM1439 scaffold00087 5 (AT)11 CTGCTATCCACGTGCTTCAA GGGGTTTAAATTCAAAATTCCA 55 222
ZMM1440 scaffold00087 5 (AT)10 AATGGAACATGAAAACCGGA TCCTTGTCATCCAATCACTCC 55 265
ZMM1451 scaffold00098 10 (TA)12 CCAACAAGATGGAATGTCCC AGGACAAGTCAATGGATGAAAA 55 263
ZMM1453 scaffold00098 10 (AT)9 CCCACACGTTAGTGATTCCA ATTTGCATGCATGAAGCGTA 55 272
ZMM1459 scaffold00105 5 (AT)15 GCCAGAGGTGGTCACAATTT GCTTCTCAACTATTCCTCCCTG 55 278
ZMM1460 scaffold00105 5 (AT)11 CTTGACCTAATTGGGAGGGG TGGGAGTATTGGGGTCTTCA 55 211
ZMM1461 scaffold00105 5 (TA)15 ACGTTGTATACATAGATCGCCTC AATTAATATTGGAGAAAGGCAATATG 55 269
ZMM1472 scaffold00109 NA (TA)11 ATAATGCGACCCATCCTCAA CCCACCGTCTCTAACCAAGA 55 232